Gene Signal

Regulatory

The European Medicines Evaluation Agency (EMA) grants Orphan Drug Designation to Aganirsen (GS-101) for the treatment of Central Retinal Vein Occlusion

On 11 June 2014, Orphan designation (EU/3/14/1275) was granted by the European Commission to Gene Signal for aganirsen (GS-101) for the treatment of Central Retinal Vein Occlusion, the most common cause of Neovascular Glaucoma. 

According to Regulation EC No 141/2000, the Committee for Orphan Medicinal Products (COMP) adopted on 6 May 2014 a positive opinion recommending the grant of the above-mentioned designation.  

View EMA decision >>

In its latest Drug Information Bulletin, the World Health Organization has published a new Proposed International Non-proprietary Name for Gene Signal’s GS-101 Antisense Oligonucleotide: Aganirsen. (WHO Drug Information, Vol. 23, No. 2, 2009)

View Drug Information Bulletin >>

The European Medicines Evaluation Agency’s (EMA) 
grants Gene Signal Orphan Drug designation on Corneal Graft Rejection : 

On 17 April 2007, Orphan designation (EU/3/07/445) was granted by the European Commission to Gene Signal for GS-101 for the prevention of Corneal Graft Rejection (Doc. Ref.: EMEA/COMP/108186/2007, 30th November 2007)

According to Regulation (EC No 141/2000 of 16 December 1999), the Committee for Orphan Medicinal Products (COMP) adopted on 8 March 2007 a positive opinion recommending the grant of the above-mentioned designation.

View EMEA Website >> 

The European Medicines Evaluation Agency (EMA) grants Orphan Drug Designation to Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) for the treatment of Neovascular Glaucoma 

On 2 October 2003, Orphan designation (EU/3/03/161) was granted by the European Commission to Gene Signal for Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) for the treatment of Neovascular Glaucoma. 

According to Regulation EC No 141/2000, the Committee for Orphan Medicinal Products (COMP) adopted on 30 July 2003 a positive opinion recommending the grant of the above-mentioned designation. 

View EMEA Website >> 

The European Medicines Evaluation Agency (EMA) grants Orphan Drug Designation to Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) for the treatment of retinopathy of prematurity 

On 2 October 2003, Orphan designation (EU/3/03/160) was granted by the European Commission to Gene Signal for Antisense oligonucleotide (TATCCGGAGGGCTCGCCATGCTGCT) for the treatment of retinopathy of prematurity. 

According to Regulation EC No 141/2000, the Committee for Orphan Medicinal Products (COMP) adopted on 30 July 2003 a positive opinion recommending the grant of the above-mentioned designation. 

View EMEA Website >>